View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_45 (Length: 250)
Name: NF12859_low_45
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14438905 - 14439148
Alignment:
| Q |
1 |
atcctatgaaagcaatggggaccttt-gtttacaaaatagtaagcttagttaaggaaaactgacatgtttattgactagnnnnnnnnnnaagaaatgttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
14438905 |
atcctatgaaagcaatggggaccttttgtatacaaaatagtaagcttagttaaggaaaactgacatgtgtattgactagttttttttt-aagaaatgttt |
14439003 |
T |
|
| Q |
100 |
attgactagttaaatgtatttattaatctatgtgtaaaaaatattaatcaacattcatttatagatgaagggagtacaatgatatgtggttttgggtaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14439004 |
attgactagttaaatgtatttattaatctatgtgtaaaaaatattaatcaacattcatttatagatgaagggagtacaatgatatgtggttttgggtaaa |
14439103 |
T |
|
| Q |
200 |
taaatagagtagtccttttaatcaaatgcaagacattcttctcac |
244 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14439104 |
taaatagagtagtccctttaatcaaatgcaagacattcttctcac |
14439148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University