View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_47 (Length: 245)
Name: NF12859_low_47
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 55076647 - 55076865
Alignment:
| Q |
19 |
cttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctctttca |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076647 |
cttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctctttca |
55076746 |
T |
 |
| Q |
119 |
gcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttcttatcaatattccttctcgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076747 |
gcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttcttatcaatattccttctcgc |
55076846 |
T |
 |
| Q |
219 |
tctcgtttcttcctttgct |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
55076847 |
tctcgtttcttcctttgct |
55076865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 113
Target Start/End: Complemental strand, 15125397 - 15125312
Alignment:
| Q |
28 |
ggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctc |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||| || ||| ||||||||||||| || ||||| |
|
|
| T |
15125397 |
ggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatggccgtcggtaatgtccttggttatgctgctggctc |
15125312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 158
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
76 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
158 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University