View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12859_low_47 (Length: 245)

Name: NF12859_low_47
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12859_low_47
NF12859_low_47
[»] chr4 (1 HSPs)
chr4 (19-237)||(55076647-55076865)
[»] chr6 (1 HSPs)
chr6 (28-113)||(15125312-15125397)
[»] chr1 (1 HSPs)
chr1 (76-158)||(43665606-43665688)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 55076647 - 55076865
Alignment:
19 cttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctctttca 118  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076647 cttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctctttca 55076746  T
119 gcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttcttatcaatattccttctcgc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076747 gcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttcttatcaatattccttctcgc 55076846  T
219 tctcgtttcttcctttgct 237  Q
    |||||||||||||||||||    
55076847 tctcgtttcttcctttgct 55076865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 113
Target Start/End: Complemental strand, 15125397 - 15125312
Alignment:
28 ggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggttatgccgccggctc 113  Q
    ||||||||||||||||||||||| |||||||  ||||||||||| ||||||||||| || ||| ||||||||||||| || |||||    
15125397 ggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatggccgtcggtaatgtccttggttatgctgctggctc 15125312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 158
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
76 atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc 158  Q
    |||||||| || || ||||| ||||| ||||||||  ||| ||||||||||| |||| ||||||| |||||| |||| |||||    
43665688 atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc 43665606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University