View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_48 (Length: 243)
Name: NF12859_low_48
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_48 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 12509186 - 12508961
Alignment:
| Q |
17 |
taatgattgatttagattctcccaaaataccaacagtgtacatattaccaagttggaagaattctcactaaccaaataaactcatccaagttgaagggag |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12509186 |
taatgattgatttagattgtcccaaaataccaacagtgtacatattaccaagttggaagaattctcactaaccaaataaactcatccaagttgaaaggag |
12509087 |
T |
|
| Q |
117 |
atcaacttgcaagtacaaatcaagcacacaatataagtattaaaaatgttaagacacttgaagacatacgtgcacaaatnnnnnnnttgatgagattggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
12509086 |
atcaacttgcaagtacaaatcaagcacacaatataagtattaaaaatgtt-agacacttgaagacatacgtgcacaaataaaaaaattgatgagatgggt |
12508988 |
T |
|
| Q |
217 |
atattctatattcttgcaatcatattt |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
12508987 |
atattctatattcttgcaatcatattt |
12508961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University