View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12859_low_60 (Length: 211)

Name: NF12859_low_60
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12859_low_60
NF12859_low_60
[»] chr3 (1 HSPs)
chr3 (42-187)||(42952323-42952468)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 42 - 187
Target Start/End: Original strand, 42952323 - 42952468
Alignment:
42 cgggattcaaaccggatcggtaaccgcagcgatgtcgtcgttcccgttccaccgtcgatctcaatcggaggtacatttccgaatccccgacgatttcgac 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42952323 cgggattcaaaccggatcggtaaccgcagcgatgtcgtcgttcccgttccaccgtcgatctcaatcggaggtacatttccgaatccccgacgatttcgac 42952422  T
142 ctcgaaatggatcccttcgacttcgacgcttctccgctccagttcc 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
42952423 ctcgaaatggatcccttcgacttcgacgcttctccgctccagttcc 42952468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University