View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_60 (Length: 211)
Name: NF12859_low_60
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 42 - 187
Target Start/End: Original strand, 42952323 - 42952468
Alignment:
| Q |
42 |
cgggattcaaaccggatcggtaaccgcagcgatgtcgtcgttcccgttccaccgtcgatctcaatcggaggtacatttccgaatccccgacgatttcgac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42952323 |
cgggattcaaaccggatcggtaaccgcagcgatgtcgtcgttcccgttccaccgtcgatctcaatcggaggtacatttccgaatccccgacgatttcgac |
42952422 |
T |
 |
| Q |
142 |
ctcgaaatggatcccttcgacttcgacgcttctccgctccagttcc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42952423 |
ctcgaaatggatcccttcgacttcgacgcttctccgctccagttcc |
42952468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University