View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1286-Insertion-14 (Length: 444)
Name: NF1286-Insertion-14
Description: NF1286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1286-Insertion-14 |
 | |
|
| [»] scaffold0775 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0775 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 8 - 435
Target Start/End: Original strand, 4331 - 4758
Alignment:
| Q |
8 |
gtgatagcatttcgctttttatttgaatttatttacacttaaaacagaacatacaacacataaaaatgtatgtattgtacattgtatccgagtactgcgt |
107 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4331 |
gtgataccattttgctttttatttgaatttatttacacttaaaacagaacatacaacacataaaaatgtatgtattgtacattgtatctgagtactgcgt |
4430 |
T |
|
| Q |
108 |
cggtttttgtatatttgaataacacaactcactttctattatggtgaagccctctttgcttggtggttttttagttaaagacaaactaatcgtaaatgat |
207 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4431 |
cagtttttgtatatttgaataacacaactcactttctattatgttgaagccctctttgcttggtggtttcttagttaaagacaaattaatcgtaaatgat |
4530 |
T |
|
| Q |
208 |
taagatctagctgttagtcattgctgctgctgcagtaggtgtgggtattgttgcttgcgtttttagttgcagtgttgcgtggaagcagtctgcgtttttg |
307 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
4531 |
taagatctagctgttagtcattgttgctgctgcagtaggtgtgtgtattgctgcttgcatttttagctgcagtgttgcgtggaagaagtctgcgtttttg |
4630 |
T |
|
| Q |
308 |
caggtgttgctactattatttggtgtgcgtatcagctgctgatgtgtttggtttatgctgattgcggctctgttcttctgtgtggggtggcagccttgat |
407 |
Q |
| |
|
||| || |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4631 |
cagctgctgctgctattatttggtgtgcgcatcagctgctgatgtgtttggtttatgctgattgcggctctgttcttctgtgtggggtggcagccttgat |
4730 |
T |
|
| Q |
408 |
tttctgttgttttttcttgctggttggg |
435 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
4731 |
tttctattgttttttcttgctggttggg |
4758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University