View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1286-Insertion-4 (Length: 189)
Name: NF1286-Insertion-4
Description: NF1286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1286-Insertion-4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 139 - 189
Target Start/End: Original strand, 43760595 - 43760645
Alignment:
| Q |
139 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattgg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760595 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattgg |
43760645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University