View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1286-Insertion-7 (Length: 178)
Name: NF1286-Insertion-7
Description: NF1286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1286-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 4e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 4e-92
Query Start/End: Original strand, 8 - 178
Target Start/End: Original strand, 442936 - 443106
Alignment:
| Q |
8 |
ttatgttgtggttgatgaagatgaaggaacacatgaaactatagaacttcatttgcttttattattggaacttcttctgtgtagaattcatagcaggatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442936 |
ttatgttgtggttgatgaagatgaaggaacacatgaaactatagaacttcatttgcttttattattggaacttcttctgtgtagaattcatagcaggatg |
443035 |
T |
|
| Q |
108 |
tttctgccatctgtgtagaattcattcattattattattctcaaatgaagcttctgccttcggtagttcct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
443036 |
tttctgccatctgtgtagaattcattcattattattattctcaaatgaagcttctgccttcggtagttcct |
443106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 10 - 37
Target Start/End: Complemental strand, 29572035 - 29572008
Alignment:
| Q |
10 |
atgttgtggttgatgaagatgaaggaac |
37 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29572035 |
atgttgtggttgatgaagatgaaggaac |
29572008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University