View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1286-Insertion-9 (Length: 68)
Name: NF1286-Insertion-9
Description: NF1286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1286-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 10396560 - 10396621
Alignment:
| Q |
7 |
attaacttagctaaccatgcacttcctgcgatagtacttccaccctctcacctttgttgtgc |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10396560 |
attaacttagctaaccatgcacttcctgcgatggtacttccaccctctcacctttgttgtgc |
10396621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 13 - 68
Target Start/End: Original strand, 8913681 - 8913739
Alignment:
| Q |
13 |
ttagctaaccatgcacttcctgcgatagtacttc---caccctctcacctttgttgtgc |
68 |
Q |
| |
|
||||||| ||||||||||||||| || |||| || |||||||||||||||||||||| |
|
|
| T |
8913681 |
ttagctagccatgcacttcctgcaatggtacatctttcaccctctcacctttgttgtgc |
8913739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University