View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12860_high_12 (Length: 288)
Name: NF12860_high_12
Description: NF12860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12860_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33542692 - 33542910
Alignment:
| Q |
1 |
tttgtgagagagaagaaaacagtgtgagttttggttttttcttcacttgctctcatgcttcacttcaacctttatcacaagctaacttgtgtttagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33542692 |
tttgtgagagagaagaaaacagtgtgagttttggttttttcttcactt----tcatgcttcacttcaacccttatcacaagctaacttgtgtttagaagg |
33542787 |
T |
 |
| Q |
101 |
gaagagaaaagctgacacataggaaaatagtttctat--gcttctgtaggatttggagacttgtagttgtccactttctgaatatcttttggattttttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33542788 |
gaagagaaaagctgacacataggaaaatagtttctatgcgcttctgtaggatttggagacttgtagttgtccactttctgaatatcttttggattttttc |
33542887 |
T |
 |
| Q |
199 |
tattatggtgtgaggtatagaag |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33542888 |
cattatggtgtgaggtatagaag |
33542910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University