View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12860_high_13 (Length: 254)
Name: NF12860_high_13
Description: NF12860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12860_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 39022132 - 39021896
Alignment:
| Q |
1 |
ctcctcattctcattccaactcatcgttgggcccacattcacgtgaatcttcttccaccagatactctgcctcacgtaagagcggtcaagcttcccataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39022132 |
ctcctcattctcattccaactcatcgttgggcccacattcacgtgaatcttcttccaccagatactctgcctcacgtaagagcagtcaagcttcccataa |
39022033 |
T |
|
| Q |
101 |
taacaggaaaggtaattggcgtccttggaaggatcagttcaatgccattgaagaagaagggcttctnnnnnnnnnnnnnnnnncagatcgtggattccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39022032 |
taacaggaaaggtaattggcgtccttggaaggatcagttcaatgccattgaagaagaagggcttcttgatgatgatgatgatgcagatcgtggattccct |
39021933 |
T |
|
| Q |
201 |
aggagatgctattttcctgcttttgttgtttgtttct |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39021932 |
aggagatgttattttcctgcttttgttgtttgtttct |
39021896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University