View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12860_high_14 (Length: 250)

Name: NF12860_high_14
Description: NF12860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12860_high_14
NF12860_high_14
[»] chr6 (2 HSPs)
chr6 (155-242)||(15966402-15966489)
chr6 (129-157)||(15966514-15966542)


Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 155 - 242
Target Start/End: Complemental strand, 15966489 - 15966402
Alignment:
155 tgaccatgaagtgtttatagtaaatgcattgcaatggtaacataccttaaatgcatttgtgaagtgtccctttttcaatcttcatctc 242  Q
    ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
15966489 tgaccatgaagtggttttagtaaatgcattgcaatggtaacataccttaaatgcatttgtgaagtggccctttttcaatcttcatctc 15966402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 157
Target Start/End: Complemental strand, 15966542 - 15966514
Alignment:
129 atttctacatgcctatccttgcagtgtga 157  Q
    |||||||||||||||||||||||||||||    
15966542 atttctacatgcctatccttgcagtgtga 15966514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University