View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12860_low_15 (Length: 283)
Name: NF12860_low_15
Description: NF12860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12860_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 266
Target Start/End: Complemental strand, 29023963 - 29023712
Alignment:
| Q |
15 |
atgaaagtggagattcaatcaagaagtgaagttatgtcaagtactataggggtagaggtacaaggaggttcaaatatgggacaaggtggacttatgagac |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29023963 |
atgaaagtggagattcaatcaaggagtgaagttatgtcaagtactataggggtagaggtacaagggggttcaaatatgggacaaggtggacttatgagac |
29023864 |
T |
|
| Q |
115 |
aacctagtatgactaaaacaaattgtctatgttcaccaacaacacatcctggttcatttcgttgtaggcttcatcgtagtcctagtcttcaaaggaccaa |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29023863 |
aacctagtatgaccaaaacaaattgtctatgttcaccaacaacacatcctggttcatttcgttgtaggcttcatcgtagtcctagtcttcaaaggaccaa |
29023764 |
T |
|
| Q |
215 |
aagcatagagccagaatcaatccctgatcagacatctagtataggtcatggt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29023763 |
aagcatagagccagaatcaatccctgatcagacatctactataggtcatggt |
29023712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 95 - 202
Target Start/End: Complemental strand, 14134028 - 14133921
Alignment:
| Q |
95 |
acaaggtggacttatgagacaacctagtatgactaaaacaaattgtctatgttcaccaacaacacatcctggttcatttcgttgtaggcttcatcgtagt |
194 |
Q |
| |
|
||||||||| ||| |||||||| | ||||||| || | |||||| |||| || |||||||||||| |||| |||||| | |||||||| ||||||| |
|
|
| T |
14134028 |
acaaggtggtcttttgagacaagcaagtatgaacaagaacaattgtttatgctctccaacaacacatgctggatcatttaggtgtaggctacatcgtaca |
14133929 |
T |
|
| Q |
195 |
cctagtct |
202 |
Q |
| |
|
|||||||| |
|
|
| T |
14133928 |
cctagtct |
14133921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University