View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12860_low_17 (Length: 270)
Name: NF12860_low_17
Description: NF12860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12860_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 47 - 257
Target Start/End: Complemental strand, 52650016 - 52649808
Alignment:
| Q |
47 |
atttcaaggaccaacttgagtatttactccacattttcctaaacacacaaagaactaaggttgaagttatgtcttgtattagagaaaaattgtaccatct |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52650016 |
atttcaaggaccaacttgagtatttactccacattttcctaaacacaca--gaagtaaggttgaagttatgtcatgtattagagaaaaattgtaccatct |
52649919 |
T |
|
| Q |
147 |
ttgagtgggttgtccacaaccaagttggcactttgcaggtctgaatgtcccagaatagttgcaggaattgcagtcaccctttgcataagccatccaaaat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52649918 |
ttgagtgggttgtccacaaccaagttggcactttgcaggtctgaatgtcccagaatagttgcaggaattgcagtcaccctttgcataagccatccaaaat |
52649819 |
T |
|
| Q |
247 |
cttcctatgct |
257 |
Q |
| |
|
||||||||||| |
|
|
| T |
52649818 |
cttcctatgct |
52649808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 138 - 258
Target Start/End: Complemental strand, 7348269 - 7348149
Alignment:
| Q |
138 |
gtaccatctttgagtgggttgtccacaaccaagttggcactttgcaggtctgaatgtcccagaatagttgcaggaattgcagtcaccctttgcataagcc |
237 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| || || | | | || |||| ||||||||| ||||| |||| ||||||||||||| || |
|
|
| T |
7348269 |
gtaccatctttgagtaggttgtccacaaccaacttggcatttcgcttgacgataagttccagcatagttgcaagaattacagttaccctttgcataaacc |
7348170 |
T |
|
| Q |
238 |
atccaaaatcttcctatgctt |
258 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
7348169 |
atccaatatcttcctatgctt |
7348149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University