View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12860_low_26 (Length: 227)
Name: NF12860_low_26
Description: NF12860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12860_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 36220357 - 36220163
Alignment:
| Q |
15 |
atgaagaaccaaaacttttaaagtgtgtaaatcaggaatattatcatacaaaagttggtaaggagacttattatgaagtaaaggaatggaaattgtatta |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36220357 |
atgaagaaccaaaactttcaaagtgtgtaaatcaggaatattatcatacaaaagttggtaaggagacttattatgaagtaaaggaatggaaattgtatta |
36220258 |
T |
|
| Q |
115 |
atgatatctgttgcatgtgatacaacataagaccaaaatgaaggtggaagctgataatgaaataaaagggctttgcaaacataaaatgtatgatg |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36220257 |
atgatatgtgttgcatgtgatacaacataagaccaaaatgaaggtggaagctgataatgaaataaaagggctttgcaaacataaaatgtacgatg |
36220163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University