View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12861_high_11 (Length: 249)
Name: NF12861_high_11
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12861_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 4092316 - 4092104
Alignment:
| Q |
18 |
ctctattggccattttggaagttatggaaagttccaggcccaccatctctgcctcttgtaggacaccttccattgctagcaaagtatggtcctgacgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092316 |
ctctattggccattttggaagttaaggaaagttccaggcccaccatctctgcctcttgtaggacaccttccattgctagcaaagtatggtcctgacgttt |
4092217 |
T |
|
| Q |
118 |
tctcagtccttgctaagcaatatggccctatctacaggtttctatattctacttgcatacatatatacaatttatcactttatttatctttcttcctctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092216 |
tctcagtccttgctaagcaatatggccctatctacaggtttctatattctacttgcatac----atacaatttatcactttatttatctttcttcctctt |
4092121 |
T |
|
| Q |
218 |
tttcttttagttctctg |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4092120 |
tttcttttagttctctg |
4092104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 158
Target Start/End: Original strand, 48175545 - 48175660
Alignment:
| Q |
43 |
ggaaagttccaggcccaccatctctgcctcttgtaggacaccttccattgctagcaaagtatggtcctgacgttttctcagtccttgctaagcaatatgg |
142 |
Q |
| |
|
|||| ||||| || |||||||||||||| | ||||| ||||||| ||||| || || |||| ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
48175545 |
ggaaggttcctggtccaccatctctgccgttggtagggcaccttcacttgctggctaaacatggccctgatgttttctcagtccttgccaagcaatatgg |
48175644 |
T |
|
| Q |
143 |
ccctatctacaggttt |
158 |
Q |
| |
|
|| || ||||||||| |
|
|
| T |
48175645 |
tccaatttacaggttt |
48175660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University