View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12861_high_15 (Length: 232)
Name: NF12861_high_15
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12861_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 45550635 - 45550763
Alignment:
| Q |
1 |
tgccagtgttagttgatgttcgcttccgctgagaatcttttatctttctggtttccttagagttagtgattgtaattgctctctgcatcttgttgtcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550635 |
tgccagtgttagttgatgttcgcttccgctgagaatcttttatctttttggtttccttagagttggtgattgtaattgctctctgcatcttgttgtcaac |
45550734 |
T |
 |
| Q |
101 |
cgagaaagttggacgtgccagttgcattt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
45550735 |
cgagaaagttggacgtgccagttgtattt |
45550763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 224
Target Start/End: Original strand, 45550814 - 45550846
Alignment:
| Q |
192 |
tctaatagtgtgattcgatttttgttctgtgct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45550814 |
tctaatagtgtgattcgatttttgttctgtgct |
45550846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University