View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12861_high_8 (Length: 298)
Name: NF12861_high_8
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12861_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 133 - 203
Target Start/End: Original strand, 15346170 - 15346240
Alignment:
| Q |
133 |
gcctaacctactgcgcatgtatttaacatggtcgaccttggctgacccactaggttaagagctagcccatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15346170 |
gcctaacctactgcgcatgtatttaacatggtcgaccttggctgacccactaggttaagagctagcccatt |
15346240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 36 - 97
Target Start/End: Original strand, 15345984 - 15346045
Alignment:
| Q |
36 |
tacaattaagctatttgtttgccacataatttttgcattgataaatgtcattaaaaacggta |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15345984 |
tacaattaagctatttgtttgccacctaatttttgcattgataaatgtcattaaaaacggta |
15346045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University