View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12861_low_11 (Length: 276)
Name: NF12861_low_11
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12861_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 30172850 - 30173099
Alignment:
| Q |
1 |
ttctcacatcccaacatggcaagcggatagctgtcattgaaaatgaggtatcgagtttgttttgtagagaaattgtaaaatgagggaagaatttgattgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30172850 |
ttctcacatcccaacatggcaagcggatagctgtcattgaaaatgaggtatcgagtttgttttgtagataaattgtaaaatgagggaagaatttgattgt |
30172949 |
T |
|
| Q |
101 |
cttattataatacggatttacagtttttcatgaaattattttgttgtgaataatgcagtttggtgaggttgatattgatggatcactggttgctagccat |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30172950 |
ctt--tataatacggatttacagtttttcatgaaattattttgttgtgaataatgcagtttggtgaggttgatattgatggatcactggttgctagccat |
30173047 |
T |
|
| Q |
201 |
tcttctgtgaatggcgaagacattatcatggtcaataatggctgcctatgct |
252 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30173048 |
tcttctgtgaatggtgaagacattatcatggtcaataatggctgcctatgct |
30173099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University