View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12861_low_15 (Length: 242)
Name: NF12861_low_15
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12861_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 30 - 225
Target Start/End: Complemental strand, 44446680 - 44446485
Alignment:
| Q |
30 |
caaaaatatgggagagattaaatagcaattaggagtaatagtgattnnnnnnnnttaccaaagcaaaaccaccggcagctgcagcacctaactcaccaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44446680 |
caaaaatatgggagagattaaatagcaattaggagtaatagtgattaaaaaaaattaccaaagcaaaaccaccggcagctgcagcacctaactcaccaag |
44446581 |
T |
 |
| Q |
130 |
atgctcatgtttgctgtggcgtttctcctccttctcataatcaacgtcttcacgacgatcatcaccataaccaccaccgatagtgggtttggtgtc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
44446580 |
atgctcatgtttgctgtggcgtttctcctccttctcataatcaacgtcttcacgacgatcatcaccataaccaccaccggtagtggttttggtgtc |
44446485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University