View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12861_low_19 (Length: 232)

Name: NF12861_low_19
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12861_low_19
NF12861_low_19
[»] chr8 (2 HSPs)
chr8 (1-129)||(45550635-45550763)
chr8 (192-224)||(45550814-45550846)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 45550635 - 45550763
Alignment:
1 tgccagtgttagttgatgttcgcttccgctgagaatcttttatctttctggtttccttagagttagtgattgtaattgctctctgcatcttgttgtcaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||    
45550635 tgccagtgttagttgatgttcgcttccgctgagaatcttttatctttttggtttccttagagttggtgattgtaattgctctctgcatcttgttgtcaac 45550734  T
101 cgagaaagttggacgtgccagttgcattt 129  Q
    |||||||||||||||||||||||| ||||    
45550735 cgagaaagttggacgtgccagttgtattt 45550763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 224
Target Start/End: Original strand, 45550814 - 45550846
Alignment:
192 tctaatagtgtgattcgatttttgttctgtgct 224  Q
    |||||||||||||||||||||||||||||||||    
45550814 tctaatagtgtgattcgatttttgttctgtgct 45550846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University