View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12861_low_20 (Length: 232)
Name: NF12861_low_20
Description: NF12861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12861_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 43 - 205
Target Start/End: Original strand, 3955691 - 3955853
Alignment:
| Q |
43 |
tctctttcataaattgagccctttannnnnnnnncaacgaacaatggtgaagaatttgatccaagaatcccttgatcaaacatatcctacctcgtagaaa |
142 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3955691 |
tctctttcataaattgagccctttatttttttttcaacgaacaatggtgaagaatttgatccaagaatcccttgatcaaacatatcctacctcgtagaaa |
3955790 |
T |
|
| Q |
143 |
agtcggagactcgagaaggaatgaaataaatatatgtctatggtaccacaagaatgatggtag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3955791 |
agtcggagactcgagaaggaatgaaataaatatatgtctatggtaccacaagaatgatggtag |
3955853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University