View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12862_low_7 (Length: 251)
Name: NF12862_low_7
Description: NF12862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12862_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 33127572 - 33127812
Alignment:
| Q |
1 |
tgttgagtattgtgaattgaatatctttgtcactactaatgaatgttttatttaaaaattaaatgtatggaacaggtaatagcagaggtgataggaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127572 |
tgttgagtattgtgaattgaatatctttgtcactactaatgaatgttttatttaaaaattaaatgtatggaacaggtaatagcagaggtgataggaacat |
33127671 |
T |
 |
| Q |
101 |
acttcttaatatttgcagggtgttgcgtagttgttctgaataaagtggaagaaactaaaggaacagtaacatttcctggaatttgtgtaacatggggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127672 |
acttcttaatatttgcagggtgttgcgtagttgttctgaataaagtggaagaaactaaaggaacagtaacatttcctggaatttgtgtaacatggggttt |
33127771 |
T |
 |
| Q |
201 |
gtcagttatgatcttggtttattctctaggtcacatctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33127772 |
gtcagttatgatcttggtttattctcttggtcacatctctg |
33127812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University