View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12862_low_9 (Length: 233)
Name: NF12862_low_9
Description: NF12862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12862_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 35186767 - 35186965
Alignment:
| Q |
13 |
cacagatagatagataggcgtgtgttaaaagacgattgtttgagcgtttgcaattaccatttctcttaata------aaaatgaaagcaacatacaccga |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35186767 |
cacagatggatagataggcgtgtgttaaaagacgattgtttgagcgtttgcaattaccatttctcttaataaaaataaaaatgaaagcaacatacaccga |
35186866 |
T |
|
| Q |
107 |
atgaaagctgaattgagatagtgcaacgtggttgtagcatgtaggttagtaactatattgacttggttttgttttggcccctctaaactttccagtctgg |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35186867 |
atgaaagctgaattgagatagtccaacgtggttgtagcatgtaggttag---------tgacttggttttgttttggcccctctcaactttccagtctgg |
35186957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University