View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12864_low_1 (Length: 544)
Name: NF12864_low_1
Description: NF12864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12864_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 6e-60; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 254 - 412
Target Start/End: Original strand, 12077085 - 12077243
Alignment:
| Q |
254 |
cttgcagatagggtttccatcatagctccaaatatcatatatttgcagcaacaaggatttgttttacgcaaacacattcaagactatatcatggtggcct |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12077085 |
cttgcagatagggtttccatcatagctccaaaaatcatatatttgcagcaacaaggatttgtttcacgcaaacacattcaagactatatcatggtggcct |
12077184 |
T |
|
| Q |
354 |
caaaagcagttaagttattggacnnnnnnncttttagaggtaacctggctatgatgata |
412 |
Q |
| |
|
|||||||||||||||| |||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
12077185 |
caaaagcagttaagttgttggtcaagaaaacttttggaggtaacctggctatgatgata |
12077243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 86 - 198
Target Start/End: Original strand, 12076916 - 12077028
Alignment:
| Q |
86 |
taacatactattggcatgtactaataaactggaaaaactggaagagattgacgatcatcgacaaaaagatagaggatattttgatgagtataataagcaa |
185 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12076916 |
taacatacttttggcatgtactaataaactggaaaaactggaagagattgacgatcatcgacaaaaagatagaggatattttgatgagtataataagcaa |
12077015 |
T |
|
| Q |
186 |
ttgattctacata |
198 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12077016 |
ttgattctacata |
12077028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 14 - 84
Target Start/End: Original strand, 12076780 - 12076852
Alignment:
| Q |
14 |
cacagagataggaa--ctgggaagctagaactcgtaagggcacaattgatcgcatgtttcaaagagaatgttg |
84 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12076780 |
cacagagataggaaaactgggaagctagaactcgtaagggcacaattgatcgcatgtttcaaagagaatgttg |
12076852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University