View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12864_low_9 (Length: 227)
Name: NF12864_low_9
Description: NF12864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12864_low_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 4931501 - 4931728
Alignment:
| Q |
1 |
actatctaaatctctacattgtcctctttttggacaaaaaatgcatatgatagtttgagggaatataaaataagnnnnnnnn-tgatcatattcacactt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
4931501 |
actatctaaatctctacattgtcctctttttggacaaaaaatgcatatgatagtttgagggaatataaaataagaaaaaaaaatgatcgtattcacactt |
4931600 |
T |
 |
| Q |
100 |
cgatgcaaatctatctatatcatctgaaggatatggaatatacatcacatatttcacctttcaccctttcaacattacaatcatttacttatcaatcatt |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931601 |
caatgcaaatctatctatatcatctgaaggatatggaatatacatcacatatttcacctttcaccctttcaacattacaatcatttacttatcaatcatt |
4931700 |
T |
 |
| Q |
200 |
tacaccatacgcccatgccgaagcctcc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4931701 |
tacaccatacgcccatgccgaagcctcc |
4931728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University