View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_14 (Length: 346)
Name: NF12865_low_14
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 43 - 327
Target Start/End: Original strand, 34869588 - 34869872
Alignment:
| Q |
43 |
agggaatatctggcattactatttgctatataatttgtggcgttattttgtatgaatataatttgcaaaacaagcctgtgtaatactgcactttaattgt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869588 |
agggaatatctggcattactatttgctatataatttgtggcgttattttgtatgaatataatttgcaaaacaagcctgtgtaatactgcactttaattgt |
34869687 |
T |
 |
| Q |
143 |
gtcggtggagatatatctttttggttattgtttaaatataaaactgtggttatttaagatgataatgtaacttttgcagaattacannnnnnnnaaaaga |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34869688 |
gtcggtggagatatatctttttggttattgtttaaatataaaactgtggttctttaagatgataatgtaacttttgcagaattaatttttttttaaaaga |
34869787 |
T |
 |
| Q |
243 |
ggatcatcttgtaatattgtgacaaaatagaaattagaatcttaagactgttgatatttttgtcgggtacaattttggtcctgca |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869788 |
ggatcatcttgtaatattgtgacaaaatagaaattagaatcttaagagtgttgatatttttgtcgggtacaattttggtcctgca |
34869872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University