View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_22 (Length: 262)
Name: NF12865_low_22
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 82 - 244
Target Start/End: Complemental strand, 31442826 - 31442664
Alignment:
| Q |
82 |
ctcaacttatttatgatatgaaactgtctataattaatgtaattttaattttaagattattataacaagatgaagagaaattgaatatttttaaaccctt |
181 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
31442826 |
ctcaacttatttatgatatgaaattgtctatgattaacgtaattttaattttaagattattataacaagatgaaaacaaattgaatatttttaagccctt |
31442727 |
T |
 |
| Q |
182 |
caaagctcccatctagtattatttttgagttactctacattaacgtaatttaatagtacaaag |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31442726 |
caaagctcccatctagtattatttttgagttactctacattaacgtaatttaatagtacaaag |
31442664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 67
Target Start/End: Complemental strand, 31443223 - 31443165
Alignment:
| Q |
9 |
ggagcagagagaatggaaaagctttggaggagatcaaggagacgagagataaagggccc |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31443223 |
ggagcagagagaatggaaaagctttggaggagatcaaagagatgagagataaagggccc |
31443165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University