View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_23 (Length: 250)
Name: NF12865_low_23
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 6454137 - 6454254
Alignment:
| Q |
1 |
tcatctctgtgttatattnnnnnnntgcaattctttaaatcaaccctagttggatcctactaaaagggtacctcgaaaacaatgcaaatcatgactcact |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454137 |
tcatctctgtgttatattaaaaaaatgcaattctttaaatcaaccctagttggatcctactaaaagggtacctcgaaaacaatgcaaatcatgactcact |
6454236 |
T |
|
| Q |
101 |
catgatcatataatcact |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6454237 |
catgatcatataatcact |
6454254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 178 - 242
Target Start/End: Original strand, 6454314 - 6454378
Alignment:
| Q |
178 |
agtactctatactataccctaattaaatcacatcctaaaatgcatactttattttcacctttgtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454314 |
agtactctatactataccctaattaaatcacatcctaaaatgcatactttattttcacctttgtt |
6454378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University