View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_24 (Length: 249)
Name: NF12865_low_24
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_24 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 34869306 - 34869543
Alignment:
| Q |
10 |
gcaaaggacagtacctaacgtgtttattggaggcaagcacattggtggttgtgattgtaaggccacactccttttgctactttttcacgaggcaaaccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869306 |
gcaaaggacagtacctaacgtgtttattggaggcaagcacattggtggttgtgattgtaaggccacactccttttgctactttttcacgaggcaaaccaa |
34869405 |
T |
 |
| Q |
110 |
aactagagttgttattgttctgtttttcattatttgtgtgtgtaatatttttatcacatgtttatttgctgcagctgttttggagaaacaccggacaggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34869406 |
aactagagttgttattgttctgtttttcatta--tgtgtgtgtaatatttttatcacatgtttatttgttgcagctgttttggagaaacaccggacaggt |
34869503 |
T |
 |
| Q |
210 |
caattggttccccttctcaatgatgctggagccatcccgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869504 |
caattggttccccttctcaatgatgctggagccatcccgc |
34869543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 34864923 - 34865162
Alignment:
| Q |
10 |
gcaaaggacagtacctaacgtgtttattggaggcaagcacattggtggttgtgattgtaaggc--cacactccttttgctactttttcacgaggcaaac- |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||| | ||||| |||||||||| |||||| |
|
|
| T |
34864923 |
gcaaaggacagtacctaatgtgtttattggaggcaagcacattggtggttgtgactgtaaggctacacactcatgttgcttctttttcacgtggcaaaga |
34865022 |
T |
 |
| Q |
107 |
caaaactagagttgttattgttctgt---ttttcattatttgtgtgtgtaatatttttatcacatgtttatttgctgcagctgttttggagaaacaccgg |
203 |
Q |
| |
|
|||||||||| ||||| || |||| | ||||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34865023 |
caaaactagacttgttttttttctttctgttttcattatttgtg--tgtaatatttttatcacatgtttatttgttgcagctattttggagaaacaccgt |
34865120 |
T |
 |
| Q |
204 |
acaggtcaattggttccccttctcaatgatgctggagccatc |
245 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
34865121 |
gcaggtcaattgattcctcttctcactgatgctggagccatc |
34865162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University