View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_26 (Length: 248)
Name: NF12865_low_26
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 32065841 - 32065609
Alignment:
| Q |
1 |
ggtgctaatcataaataccaatagtggtggacatgctgtgattggcttctactttgcaaaagagctacttggtgctggacactctgtcaccattctcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32065841 |
ggtgctaatcataaataccaatagtggtggacatgctgtgattggcttctactttgcaaaagagctacttggtgctggacactctgtcaccattctcact |
32065742 |
T |
 |
| Q |
101 |
gttggtgatgaaagctcagataagatgaagaaacctccttttaacagattctcagttaatgatctttatctcattctcacactcattccgaaagaattgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
32065741 |
gttggtgatgaaagctcagataagatgaagaaacctccttttaacagattctcagttaatgatctttatctcattctcaaactcattccgaaagaatttt |
32065642 |
T |
 |
| Q |
201 |
tcttttcactacagtacactgctatttgcattg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32065641 |
tcttttcactacagtacactgctatttgcattg |
32065609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University