View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_28 (Length: 240)
Name: NF12865_low_28
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 232
Target Start/End: Original strand, 6453927 - 6454143
Alignment:
| Q |
16 |
actttgatgaccactgctactaatattatctcaggcctcagcttccataaataactagtactacactaccctttttcactaacttttcgctcaaaccacc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6453927 |
actttgatgaccactgctactaatattatatcaggcctcagcttccataaataactagtactatacttccctttttcactaacttttcgctcaaaccacc |
6454026 |
T |
 |
| Q |
116 |
atccccnnnnnnnctctgatcttttctctttctcttcatttaatcttttttcctttatnnnnnnntctctatctctgactaagttactagt-agtctctg |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
6454027 |
atccccaaaaaaactctgatcttttctctttctcttcatttaatcttttttcctttat-aaaaaatctctatctctgactaagttactagtaagtctctg |
6454125 |
T |
 |
| Q |
215 |
gaaaaattaattcatctc |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6454126 |
gaaaaattaattcatctc |
6454143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University