View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_33 (Length: 215)
Name: NF12865_low_33
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 30697704 - 30697893
Alignment:
| Q |
19 |
ttatcatcacaacccaaacttgaa-ttttgtttgtactcaaactaatatacttgtaattcaatagaaaagtaacgaatttccctgaatgataaattatga |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||| ||| | ||| ||||||||||||||| |
|
|
| T |
30697704 |
ttatcatcacaacccaaacttgaacttttgtttatactcaaactaatatacttgtaattcaatagaaaaataacaaatcttccttaatgataaattatga |
30697803 |
T |
|
| Q |
118 |
aaagtctttaactaacccgacaatggaacaactaacatttgatgcattcttttgctcaaaagattatagttctctagacttcatctcact |
207 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
30697804 |
aaagtctttaactaacccagctatggaacaactaacatttgatgcattctttttctcaaaagattatagttctctagactttatgtcact |
30697893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University