View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12865_low_36 (Length: 213)

Name: NF12865_low_36
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12865_low_36
NF12865_low_36
[»] chr7 (1 HSPs)
chr7 (18-202)||(48174250-48174435)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 48174435 - 48174250
Alignment:
18 aatctatgcatgtaaaaggacatgcacgtacctcaaaataatgtccattcaaattctcccccttttctctccgatacaacctcaaca-nnnnnnnngcat 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||    
48174435 aatctatgcatgtaaaaggacatgcacgtacctcaaaataatgtccattcaaattctcccccttttctctccgatacaacctcaacatttttttttgcat 48174336  T
117 tcccatcatcattgcatgcatggcttcctcttcctttcaccttttcttcttgatcattctccttccatttttatagcctttgcttc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
48174335 tcccatcatcattgcatgcatggcttcctcttcctttcaccttttcttcttgatcattctccttccatttttatagcctctgcttc 48174250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University