View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12865_low_36 (Length: 213)
Name: NF12865_low_36
Description: NF12865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12865_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 48174435 - 48174250
Alignment:
| Q |
18 |
aatctatgcatgtaaaaggacatgcacgtacctcaaaataatgtccattcaaattctcccccttttctctccgatacaacctcaaca-nnnnnnnngcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48174435 |
aatctatgcatgtaaaaggacatgcacgtacctcaaaataatgtccattcaaattctcccccttttctctccgatacaacctcaacatttttttttgcat |
48174336 |
T |
 |
| Q |
117 |
tcccatcatcattgcatgcatggcttcctcttcctttcaccttttcttcttgatcattctccttccatttttatagcctttgcttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48174335 |
tcccatcatcattgcatgcatggcttcctcttcctttcaccttttcttcttgatcattctccttccatttttatagcctctgcttc |
48174250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University