View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12866_low_3 (Length: 272)
Name: NF12866_low_3
Description: NF12866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12866_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 21267721 - 21267920
Alignment:
| Q |
16 |
ttaactgtaatggagctgtggtgatcgacagagttgttggttgtggtggcgtcataagcgatagtgttataggcatcattggcattgctttgtatcagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21267721 |
ttaactgtaatggagctgtggtgatcgacagagttgttggctgtggtggcgtcataagcgataatgttataggcatcattggcattgctttgtatcagaa |
21267820 |
T |
|
| Q |
116 |
ccaagttaattcgcatattctgacttttgttatcttgtatataagatggccagnnnnnnnncatgttttcatgggagaacctaagtatatttagattccc |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21267821 |
ccaagttaagtcgcatattctgacttttgttatcttgtatataagatggccag-aaaaaaacatgttttcatgggagaccctaagtatatttagattccc |
21267919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University