View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12866_low_5 (Length: 240)
Name: NF12866_low_5
Description: NF12866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12866_low_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 39775244 - 39775467
Alignment:
| Q |
17 |
aacagaagtatatttctgctgcaaaagtaaatagtcatcctaatactttactatgttctaaaagtaaacaattgtgggatggaataaacattatggtgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39775244 |
aacagaagtatatttctgctgcaaaagtaagtagtcatcctaatactttactatgttctaaaagtaaacaactgtgggatggaataaacattatggtgca |
39775343 |
T |
|
| Q |
117 |
tgattgcatataattgatgctcttgctatacatgtcctaaagttgtgtatgattgttgttggaaaatgaaactaatagtagtagtaattttgatcttaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775344 |
tgattgcatataattgatgctcttgctatacatgtcctaaagttgtgtatgattgttgttggaaaatgaaactaatagtagtagtaattttgatcttaca |
39775443 |
T |
|
| Q |
217 |
agcgatgtttaattaagcatgacc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39775444 |
agcgatgtttaattaagcatgacc |
39775467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University