View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_high_17 (Length: 317)
Name: NF12868_high_17
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 27 - 304
Target Start/End: Complemental strand, 34749154 - 34748877
Alignment:
| Q |
27 |
accctatgcttaacaaaatttaacagaatgatgtttaccaacctgtgatgtcgatttcagtaactttgatgctatgaaaaataaggaatctgcatggaat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749154 |
accctatgcttaacaaaatttaacagaatgatgtttacaaacctgtgatgtcgatttcagtaactttgatgctatgaaaaataaggaatctgcatggaat |
34749055 |
T |
 |
| Q |
127 |
tttcaaatgtcatatattcatcctttgatgaaatgaaatttagattcaaattatcaaactaaatgtaactttttatatgcttaattacctgttattaacc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749054 |
tttcaaatgtcatatattcatcctttgatgaaatgaaatttagattcaaattatcaaactaaatgtaactttttatatgcttaattacctgttattaacc |
34748955 |
T |
 |
| Q |
227 |
ccttgtgagatttaataattcctgtctttacaatacctggatgaactgcattcatagttactcttgctttccttgcct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34748954 |
ccttgtgagatttaataattcctgtctttacaatacctggatgaactgcattcatagttactcttgctttccttgcct |
34748877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 217 - 304
Target Start/End: Complemental strand, 43691882 - 43691795
Alignment:
| Q |
217 |
gttattaaccccttgtgagatttaataattcctgtctttacaatacctggatgaactgcattcatagttactcttgctttccttgcct |
304 |
Q |
| |
|
|||||||| ||||| || | | |||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |||||||||| |
|
|
| T |
43691882 |
gttattaagcccttatgtgctctaataattcctgtcttcacaatgcctggatgcactgcattgatagttactcttgcattccttgcct |
43691795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 61 - 129
Target Start/End: Complemental strand, 43692023 - 43691955
Alignment:
| Q |
61 |
ttaccaacctgtgatgtcgatttcagtaactttgatgctatgaaaaataaggaatctgcatggaatttt |
129 |
Q |
| |
|
|||| |||||||||||||| ||| || | ||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
43692023 |
ttacaaacctgtgatgtcgttttgagcagctttgatgcaataaaaaacaaggaatctgcatggaatttt |
43691955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 129
Target Start/End: Complemental strand, 43694358 - 43694317
Alignment:
| Q |
88 |
aactttgatgctatgaaaaataaggaatctgcatggaatttt |
129 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
43694358 |
aactttgatgcaatgaaaaagaagtaatctgcatggaatttt |
43694317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University