View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_high_25 (Length: 240)
Name: NF12868_high_25
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 52512533 - 52512756
Alignment:
| Q |
16 |
gcagcaacatcacttgtccattgatgactatgatgataacctaaatcttgattcatgtaattgttcttgtgtgttaaagatgatattgatctggtattag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52512533 |
gcagcaacatcacttgtccattgatgactatgatgataacctaaatcatgattcatataattgttcttgtgtgttaaagatgatcttgatctggtattag |
52512632 |
T |
 |
| Q |
116 |
cttcttggaggttatttgagttgatgttgcctgcattattcctatagatagatgtataaacaaggttagaaaaaagaaattaagagaaaataggacacca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512633 |
cttcttggaggttatttgagttgatgttgcctgcattattcctatagatagatgtataaacaaggttagaaaaaagaaattaagagaaaataggacacca |
52512732 |
T |
 |
| Q |
216 |
tgtagtatatatatcacttcatct |
239 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
52512733 |
tgtagtatatatatcactttatct |
52512756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University