View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_high_28 (Length: 231)
Name: NF12868_high_28
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 220
Target Start/End: Original strand, 48999467 - 48999666
Alignment:
| Q |
21 |
agtaaagcatacagagaatcaatctgagaatgaagatcttctgaatcaagcattccaacgagaggagaaatagccccgagcattgcgagtgagcctctcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48999467 |
agtaaagcatacagagaatcaatctgagaatgaagatcttctgaatcaagcattccaacgagaggagaaatagccccgagcattgcgagtgagcctctcg |
48999566 |
T |
 |
| Q |
121 |
cttcggaatcttctttcgtcagtgatcttactctcgccgccgctattcgccgcttcgtcgagtcttcttcacgtaaatccttaaccacatgcttcatctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
48999567 |
cttcggaatcttctttcgtcagtgatcttactctcgctgccgctattcgccgctttgtcgagtcttctccgcgtaaatccttaaccacatgcttcatctc |
48999666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University