View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12868_high_30 (Length: 225)

Name: NF12868_high_30
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12868_high_30
NF12868_high_30
[»] chr8 (1 HSPs)
chr8 (1-209)||(34427564-34427772)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 34427564 - 34427772
Alignment:
1 gagattgcgggagaaggttgatttgccacagttacttgctccacaaacaagtgtgatgggaggagttggactggatgttatggagttggcagcttgtgac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
34427564 gagattgcgggagaaggttgatttgccacagttacttgctccacaaacaagtgtgatgggaggagttggactggatgttatggagttagcagcttgtgac 34427663  T
101 cattgttgtgggatgtaaatgtctggaaggacaaaagcagaagatgaacccattgctctttcnnnnnnngtatgtgaaactgcaaaaccgatacactttg 200  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||| ||||||||||||||||||||    
34427664 catttttgtgggatgtaaatgtctggaaggacaaaagcagaagatgaacccattgctctttctttttttgtatgtgaaattgcaaaaccgatacactttg 34427763  T
201 attataaaa 209  Q
    |||||||||    
34427764 attataaaa 34427772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University