View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_high_32 (Length: 216)
Name: NF12868_high_32
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 32024166 - 32023971
Alignment:
| Q |
1 |
ttcaattttgcagtaacctcagcgcacttttcaacaagatcttcatttttgtcttcagcttctttcacgcaatcttcccaattgatgaacgtgtctttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024166 |
ttcaattttgcagtaacctcagcgcacttttcaacaagatcttcatttttgtcttcagcttctttcacgcaatcttcccaattgatgaacgtgtctttgc |
32024067 |
T |
 |
| Q |
101 |
aaccgcctcctttcatgaataggcagaatccgcattctccttcttcttcctcttcctcgccttcggcggcggtttctggttcgggagactccggtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024066 |
aaccgcctcctttcatgaataggcagaatccgcattctccttcttcttcctcttcctcgccttcggcggcggtttctggttcgggagactccggtg |
32023971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 153
Target Start/End: Complemental strand, 32026879 - 32026802
Alignment:
| Q |
76 |
tcccaattgatgaacgtgtctttgcaaccgcctcctttcatgaataggcagaatccgcattctccttcttcttcctct |
153 |
Q |
| |
|
||||||| || ||| |||||| |||||||||||||||||||||| | |||||| || || || |||||||| |||||| |
|
|
| T |
32026879 |
tcccaatcgacgaaggtgtctctgcaaccgcctcctttcatgaacacgcagaacccacactcaccttcttcctcctct |
32026802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University