View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_low_19 (Length: 316)
Name: NF12868_low_19
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 18 - 302
Target Start/End: Complemental strand, 47093390 - 47093106
Alignment:
| Q |
18 |
agcggtggtgatgcaaatggagcaagagagagagttagaacaaaaagtaaaaagagcgcaagttgcaaagagtgggagtttaatattctgtgcgggtgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47093390 |
agcggtggtgatgcaaatggagcaagagagagagttagaacaaaaagtaaaaagagcgcaagttgcaaagagtgggagtttaatattctgtgcgggtgag |
47093291 |
T |
 |
| Q |
118 |
tctcaggtgtatacgctggaccagttgatgaaaggttctgcggagctattaggaagagggtgtttaggaacaacttataaagcggtgcttgataaccgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47093290 |
tctcaggtgtatacgctggaccagttgatgaaaggttctgcggagctattaggaagagggtgtttaggaacaacttataaagcggtgcttgataaccgtt |
47093191 |
T |
 |
| Q |
218 |
tgattgtaacagtgaagcgtcttgattgtgcgaaaatgggtgggtatgttagtaaggatgtttttgagcgtcacatggaatcagt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47093190 |
tgattgtaacagtgaagcgtcttgattgtgcgaaaatgggtgggtatgttagtaaggatgtttttgagcgtcacatggaatcagt |
47093106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University