View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_low_23 (Length: 261)
Name: NF12868_low_23
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 42069799 - 42070003
Alignment:
| Q |
18 |
gtatccaccactttgagctggaatatgttccatgcacatggagtgatcaactttttccaagcctaggactgttgatgttgaaacatcaacttttttctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069799 |
gtatccaccactttgagctggaatatgttccatgcacatggagtgatcaactttttccaagcctaggactgttgatgttgaaacatcaacttttttctgt |
42069898 |
T |
 |
| Q |
118 |
tgccatttcgttccaaattttatgttccaataaataaaatcattctatgctgatgcaaataaatctatgcttgttggtctaaaatcaatctacaatttcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42069899 |
tgccatttcgttccaaattttatgttccaataaataaaatcatactatgctgatgcaaataaatctatgcttgttggtctaaaatcaatctacaatttcc |
42069998 |
T |
 |
| Q |
218 |
aaaca |
222 |
Q |
| |
|
||||| |
|
|
| T |
42069999 |
aaaca |
42070003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University