View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_low_25 (Length: 248)
Name: NF12868_low_25
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 11694299 - 11694090
Alignment:
| Q |
1 |
aagaatttattcttattttaccaagttttcattattttataacctttcttgcctaaaacggaaaaattaaaattgttttaaggtttttctctgatagagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
11694299 |
aagaatttattcttattttaccaagtttttattattttataacctttcatgactaaaacggaaaaattaagattgttttaaggtttttctctgataatgt |
11694200 |
T |
 |
| Q |
101 |
tttgaactttatgcctagcgtaacacccttataaactctttgtatttttacat---tttgttatgtagaacttgaattaagtctggtacca-caagtggt |
196 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||| || || |||| |
|
|
| T |
11694199 |
tttgaactttatgtctagcgtaacacccttataaactctttgtatttttaaatgactttgttacgtagaacttgaattaagtctggtatcataaaatggt |
11694100 |
T |
 |
| Q |
197 |
tttataaata |
206 |
Q |
| |
|
|||||||||| |
|
|
| T |
11694099 |
tttataaata |
11694090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University