View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_low_28 (Length: 233)
Name: NF12868_low_28
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 52768794 - 52768591
Alignment:
| Q |
19 |
cttatgataactggtggacagtttatttcttatctagtaaatctttcttttacgcaggtttattttccacacttttctctttcatccattttcattaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52768794 |
cttatgataactggtggacagtttatttcttatctagtaaatctttcttttacgcaggtttattttccacacttgtctctttcatccattttcattaaaa |
52768695 |
T |
|
| Q |
119 |
tatctttgacatcgtatcccatttaactgcatatagctcttatttagaagtacgaaagccaatttctcccttgtcgaattgatttttccttgttccctat |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52768694 |
tatctttgacattgtatcccatttaactgcatatagctcttatttagaagtacgaaagccaatttctcccttgtcgaattgatttttccttgttctctat |
52768595 |
T |
|
| Q |
219 |
gctt |
222 |
Q |
| |
|
|||| |
|
|
| T |
52768594 |
gctt |
52768591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 38013755 - 38013711
Alignment:
| Q |
19 |
cttatgataactggtggacagtttatttcttatctagtaaatctt |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
38013755 |
cttatgataactggtggacagtttctttcttacctcgtaaatctt |
38013711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University