View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_low_31 (Length: 225)
Name: NF12868_low_31
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 34427564 - 34427772
Alignment:
| Q |
1 |
gagattgcgggagaaggttgatttgccacagttacttgctccacaaacaagtgtgatgggaggagttggactggatgttatggagttggcagcttgtgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34427564 |
gagattgcgggagaaggttgatttgccacagttacttgctccacaaacaagtgtgatgggaggagttggactggatgttatggagttagcagcttgtgac |
34427663 |
T |
|
| Q |
101 |
cattgttgtgggatgtaaatgtctggaaggacaaaagcagaagatgaacccattgctctttcnnnnnnngtatgtgaaactgcaaaaccgatacactttg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
34427664 |
catttttgtgggatgtaaatgtctggaaggacaaaagcagaagatgaacccattgctctttctttttttgtatgtgaaattgcaaaaccgatacactttg |
34427763 |
T |
|
| Q |
201 |
attataaaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
34427764 |
attataaaa |
34427772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University