View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12868_low_34 (Length: 211)
Name: NF12868_low_34
Description: NF12868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12868_low_34 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 7 - 211
Target Start/End: Complemental strand, 26753851 - 26753647
Alignment:
| Q |
7 |
agatttaacacgatcagcttggatactaagctcactgcaaacccttctttcaaccatatcgaaacgaaaaacaaatttataatatgtaggattttggaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26753851 |
agatttaacacgatcagcttggataccaagctcactgcaaacccttctttcaaccatatcgaaacgaaaaacaaatttataatatgtaggattttggaat |
26753752 |
T |
 |
| Q |
107 |
caaaattggttttcctttctatggagttcaatcactagaagaagaaacactctaatgtttttgctttcataggaagttcacattgccaagagaagaggca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26753751 |
caaaattggttttcctttctatggagttcaatcactagaagaagaaacactctaatgtttttgctttcataggaagttcacattgccaagagaagaggca |
26753652 |
T |
 |
| Q |
207 |
atgaa |
211 |
Q |
| |
|
||||| |
|
|
| T |
26753651 |
atgaa |
26753647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University