View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12870_low_3 (Length: 294)
Name: NF12870_low_3
Description: NF12870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12870_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 43817314 - 43817580
Alignment:
| Q |
18 |
tttcgcatccaccgtctctcccttttccgtggacccacatattttcgtatcacgcgataaatctacactctcatcaaagaaagtgtagttatcataacga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817314 |
tttcgcatccaccgtctctcccttttccgtggacccacatattttcgtatcacgcgataaatctacactctcatcaaagaaagtgtagttatcataacga |
43817413 |
T |
 |
| Q |
118 |
agaaaacaaccgtcgaggtaaattctacctgaaacctttggtatgcacctcgataacaattgtcttgcttgggtgaaacaaatgttgcattgtgtcggat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817414 |
agaaaacaaccgtcgaggtaaattctacctgaaacctttggtatgcacctcgataacaattgtcttgcttgggtgaaacaaatgttgcattgtgtcggat |
43817513 |
T |
 |
| Q |
218 |
caagatcgcgttgacattggcctaatgcatacattggatgccaattaccaactaatgtctgtgctcc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43817514 |
caagatcgcgttgacattggcctaatgcatacattggatgccaattaccaactaatgtttgtgctcc |
43817580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University