View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12870_low_4 (Length: 283)
Name: NF12870_low_4
Description: NF12870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12870_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 108 - 267
Target Start/End: Original strand, 22665484 - 22665643
Alignment:
| Q |
108 |
tatacaccctacacaaaacatttccctaaatgaaattacatgattgaacatgcgtttgcattgtcatcattaaaaagtgccatcatcttcaactctggag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665484 |
tatacaccctacacaaaacatttccctaaatgaaattacatgattgaacatgcgtttgcattgtcatcattaaaaagtgccatcatcttcaactctggag |
22665583 |
T |
|
| Q |
208 |
acttagggtcacccacagcttgagggacacctctgacgaaaccagttggtgctttcatgt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665584 |
acttagggtcacccacagcttgagggacacctctgacgaaaccagttggtgctttcatgt |
22665643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University