View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12870_low_6 (Length: 251)
Name: NF12870_low_6
Description: NF12870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12870_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 94 - 232
Target Start/End: Complemental strand, 42165753 - 42165615
Alignment:
| Q |
94 |
cctagggtagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165753 |
cctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac |
42165654 |
T |
|
| Q |
194 |
ttcttactcattgtcttaatattggcatatctgctctcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42165653 |
ttcttactcattgtcttaatattggcatatttgctctcc |
42165615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 109 - 230
Target Start/End: Complemental strand, 5481266 - 5481145
Alignment:
| Q |
109 |
atggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtc |
208 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| || ||||| || ||||||||||| | |||||||| ||||||||||||||||||||||||| | || |
|
|
| T |
5481266 |
atgggtggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactcgtgttc |
5481167 |
T |
|
| Q |
209 |
ttaatattggcatatctgctct |
230 |
Q |
| |
|
| ||| ||||||| |||||||| |
|
|
| T |
5481166 |
tcaatcttggcatctctgctct |
5481145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 67
Target Start/End: Complemental strand, 42165823 - 42165776
Alignment:
| Q |
20 |
ataaagcaccaagttttcagtggtctcatcacacactcactctcttac |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165823 |
ataaagcaccaagttttcagtggtctcatcacacactcactctcttac |
42165776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 114 - 245
Target Start/End: Original strand, 47170183 - 47170314
Alignment:
| Q |
114 |
tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtcttaat |
213 |
Q |
| |
|
|||||||||||||||||| ||||| || || |||||||||||||| ||||||||||| |||||| ||||||||||||| |||||||| | ||||| ||| |
|
|
| T |
47170183 |
tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgtctcaat |
47170282 |
T |
|
| Q |
214 |
attggcatatctgctctccagtcctatgcttc |
245 |
Q |
| |
|
| || || |||||||||| ||| ||||||| |
|
|
| T |
47170283 |
ctcggtatctctgctctccgatccaatgcttc |
47170314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University