View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12870_low_6 (Length: 251)

Name: NF12870_low_6
Description: NF12870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12870_low_6
NF12870_low_6
[»] chr1 (3 HSPs)
chr1 (94-232)||(42165615-42165753)
chr1 (109-230)||(5481145-5481266)
chr1 (20-67)||(42165776-42165823)
[»] chr3 (1 HSPs)
chr3 (114-245)||(47170183-47170314)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 94 - 232
Target Start/End: Complemental strand, 42165753 - 42165615
Alignment:
94 cctagggtagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac 193  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42165753 cctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac 42165654  T
194 ttcttactcattgtcttaatattggcatatctgctctcc 232  Q
    |||||||||||||||||||||||||||||| ||||||||    
42165653 ttcttactcattgtcttaatattggcatatttgctctcc 42165615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 109 - 230
Target Start/End: Complemental strand, 5481266 - 5481145
Alignment:
109 atggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtc 208  Q
    |||| ||||||||| ||||||||||||||||| || ||||| || ||||||||||| |  |||||||| ||||||||||||||||||||||||| |  ||    
5481266 atgggtggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactcgtgttc 5481167  T
209 ttaatattggcatatctgctct 230  Q
    | ||| ||||||| ||||||||    
5481166 tcaatcttggcatctctgctct 5481145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 67
Target Start/End: Complemental strand, 42165823 - 42165776
Alignment:
20 ataaagcaccaagttttcagtggtctcatcacacactcactctcttac 67  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
42165823 ataaagcaccaagttttcagtggtctcatcacacactcactctcttac 42165776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 114 - 245
Target Start/End: Original strand, 47170183 - 47170314
Alignment:
114 tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtcttaat 213  Q
    |||||||||||||||||| ||||| || || |||||||||||||| ||||||||||| |||||| ||||||||||||| ||||||||  | ||||| |||    
47170183 tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgtctcaat 47170282  T
214 attggcatatctgctctccagtcctatgcttc 245  Q
     | || || ||||||||||  ||| |||||||    
47170283 ctcggtatctctgctctccgatccaatgcttc 47170314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University