View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12870_low_8 (Length: 234)
Name: NF12870_low_8
Description: NF12870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12870_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 5192465 - 5192666
Alignment:
| Q |
14 |
gcataggccagtcgttgtgtctcatgcgtaagctagaaaaaatatacctaggcaagctcgtcacaccacaacgagatcgcgtagaatcatataagttaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
5192465 |
gcataggccagtcgttgtgtctcatgcgtaatctaaaaaaaatatacctaggcaagctcgtcacaccacaacgagatcgcctagaatcacacaagttaac |
5192564 |
T |
|
| Q |
114 |
gtcaaggttatatatagatgtcttcataaaaaatgtaggtatggatattagggattcaatggctttgatttcaaaactcaaaagaatgacaaagacatat |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5192565 |
gtcaaggttatgtatagatgtcttcataaaaaatgtaggtatggattttagggattcaatggctttgatttcaaaactcaaaagaatgacaaagacatat |
5192664 |
T |
|
| Q |
214 |
at |
215 |
Q |
| |
|
|| |
|
|
| T |
5192665 |
at |
5192666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University